If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
Correspondence: Kentaro Izumi, Department of Dermatology, Faculty of Medicine and Graduate School of Medicine, Hokkaido University, North 15 West 7, Kita-Ku, Sapporo 060-8638, Japan.
Pemphigoid diseases are a group of autoimmune disorders characterized by subepidermal blistering in the skin and mucosa. Among them, mucous membrane pemphigoid (MMP) autoantibodies are characterized by targeting multiple molecules in the hemidesmosomes, including collagen XVII, laminin-332, and integrin a6/β4. Traditionally, recombinant proteins of the autoantigens have been employed to identify circulating autoantibodies by immune assays. However, developing an efficient detection system for MMP autoantibodies has been challenging because the autoantibodies have heterogeneous profiles and the antibody titers are typically low. In this study, we introduce an ELISA that takes advantage of a native autoantigen complex rather than simple recombinant proteins. We generated HaCaT keratinocytes with a DDDDK-tag knocked in at the COL17A1 locus by CRISPR/Cas9-mediated gene editing. Immunoprecipitation using the DDDDK-tag isolated a native complex that contained full-length and processed collagen XVII and integrin α6/β4. Then, we used the complex proteins to prepare an ELISA system and enrolled 55 MMP cases to validate its diagnostic performance. The sensitivity and specificity of the ELISA for detecting MMP autoantibodies were 70.9% and 86.7%, respectively, far superior to those of conventional assays. In autoimmune diseases such as MMP, in which autoantibodies target various molecules, isolating the antigen-protein complexes can help establish a diagnostic system.
). Autoantibody detection is essential for correctly diagnosing any autoimmune disease. Various recombinant autoantigens have been used as substrates for ELISA, chemiluminescent enzyme immunoassay, or western blotting (
). However, a recombinantly expressed protein is not equivalent to a native autoantigen because the former typically lacks posttranslational modifications, including the cleavage of precursors (
). These differences can be responsible for the failure of autoantibody detection in recombinant protein assays.
Pemphigoid diseases are autoimmune blistering disorders characterized by autoantibodies targeting proteins in the hemidesmosomes (HDs) at the dermal-epidermal junction (
The N terminus of the transmembrane protein BP180 interacts with the N-terminal domain of BP230, thereby mediating keratin cytoskeleton anchorage to the cell surface at the site of the hemidesmosome.
Direct interaction between the intracellular domains of bullous pemphigoid antigen 2 (BP180) and beta 4 integrin, hemidesmosomal components of basal keratinocytes.
Hemidesmosome formation is initiated by the β4 integrin subunit, requires complex formation of β4 and HD1/plectin, and involves a direct interaction between β4 and the Bullous pemphigoid antigen 180.
Molecular genetic studies of a human epidermal autoantigen (the 180-kD bullous pemphigoid antigen/BP180): identification of functionally important sequences within the BP180 molecule and evidence for an interaction between BP180 and alpha 6 integrin.
Epiligrin, the major human keratinocyte integrin ligand, is a target in both an acquired autoimmune and an inherited subepidermal blistering skin disease.
Bullous pemphigoid (BP), the most common pemphigoid disease, is clinically characterized by itchy urticarial eruptions associated with the formation of tense blisters (
European guidelines (S3) on diagnosis and management of mucous membrane pemphigoid, initiated by the European Academy of Dermatology and Venereology – part I.
European Guidelines (S3) on diagnosis and management of mucous membrane pemphigoid, initiated by the European Academy of Dermatology and Venereology – part II.
The first international consensus on mucous membrane pemphigoid: definition, diagnostic criteria, pathogenic factors, medical treatment, and prognostic indicators.
European Guidelines (S3) on diagnosis and management of mucous membrane pemphigoid, initiated by the European Academy of Dermatology and Venereology – part II.
Bullous pemphigoid antigen II (BP180) and its soluble extracellular domains are major autoantigens in mucous membrane pemphigoid: the pathogenic relevance to HLA class II alleles and disease severity.
Clinical and immunological studies of 332 Japanese patients tentatively diagnosed as anti-BP180-type mucous membrane pemphigoid: a novel BP180 C-terminal domain enzyme-linked immunosorbent assay.
). Because the rCOL17 ELISA can detect anti-COL17 autoantibodies that target not only the NC16A region but also other regions of COL17, it shows higher sensitivity than the conventional NC16A ELISA in detecting MMP autoantibodies (
), the rCOL17 ELISA cannot identify all the MMP autoantibodies.
In this study, we isolated native COL17 (nCOL17) by inserting a DDDDK-tag into the endogenous COL17A1 gene of keratinocytes through CRISPR/Cas9 gene editing (
). The isolated nCOL17 forms a complex with other COL17-binding proteins, including ITGα6/β4, and is expected to improve the sensitivity of MMP autoantibody detection. In this study we evaluate the diagnostic performance of the isolated nCOL17-related autoantigen complex as the substrate for a MMP diagnostic system.
Results
Insertion of DDDDK-tag sequence into the COL17A1 gene in HaCaT
First, we used a lentiviral vector system to establish HaCaT cells (an immortalized human keratinocytes cell line) that stably express Cas9 proteins (Cas9(+) HaCaT). Cas9 expression was confirmed by western blotting for the selected clones (Figure 1a), and a Cas9(+) clone with a cobblestone-like appearance was isolated (Figure 1b). Then, to label the endogenous COL17, we used a guide RNA that targeted exon 2 of the COL17A1 gene and single-strand nucleotides containing the DDDDK-tag flanked by left and right 50-based homology arms to transfect Cas9(+) HaCaT (Figure 1c), and we obtained one clone of Cas9(+) HaCaT expressing the DDDDK-tagged COL17 (DDDDK-COL17 HaCaT) (Figure 1d). The colocalization of COL17 and the DDDDK-tag was confirmed in the DDDDK-COL17 HaCaT (Figure 1e).
Figure 1Generation of HaCaT stably expressing endogenous DDDDK-tagged COL17. (a) Western blotting to confirm Cas9 expression in HaCaT stably expressing Cas9 (referred to as Cas9(+) HaCaT) selected according to puromycin resistance. (b) The isolated Cas9(+) clone shows a cobblestone-like appearance. Bar = 500 μm. (c) In-frame insertion of the ssDNA containing the DDDDK-tag sequence to the exon2 of COL17A1 gene after the homologous directed repair. (d) When the DDDDK-tag was successfully knocked into the COL17A1 gene, the fusion protein showed a double-positive for anti-DDDDK and anti-COL17. Western blotting showed one clone was positive for anti-DDDDK and anti-COL17. CNT: Cas9(+) HaCaT. (e) Immunofluorescence images of HaCaT. Number 12 clone showed DDDDK signals colocalized with COL17 NC16A. Bar = 50 μm. COL17, collagen XVII; ssDNA, single-strand DNA.
The establishment of DDDDK-COL17 HaCaT allowed us to purify nCOL17, a DDDDK-tagged COL17, by immunoprecipitation (Figure 2a). Coomassie brilliant blue staining of nCOL17 showed not only 180-kDa COL17 but also additional 250-, 160-, 130-, and120-kDa bands (Figure 2b). Mass spectrometry analysis revealed that these additional bands were processed COL17 and cell adhesion molecules. The band at around 250-kDa was ITGβ4; that around 160-kDa was a short fragment of COL17; those around 130-kDa were ITGα6, desmoglein (DSG)-1, DSG-3, and desmocorrin-1; that around 120-kDa was a fragment of COL17; those around 120-kDa were ITGα6 and E-cadherin (Figure 2c). Of these cell adhesion molecules, ITGα6, ITGβ4, and E-cadherin were confirmed by western blotting (Figure 2d). However, western blotting was unable to detect BP230, DSG-1, DSG-3, desmocollin-1, and laminin-332 (data not shown). Interestingly, short extra COL17 fragments of 160-kDa and 120-kDa were detected in nCOL17 but were scarcely found in rCOL17 (Figure 2d). A 120-kDa COL17 was also identified by the Ab 09040 antibody, which recognizes the C-terminus of COL17 (
). The 160-kDa COL17 is stained by DDDDK-tag western blotting, indicating that the N-terminally attached DDDDK-tag is maintained and that it is a C-terminally truncated COL17 or transcript variant. The immunoprecipitation steps possibly helped the short COL17 bands become visible because the bands were not apparent in the cell lysate (Figure 2d). These results show that nCOL17 forms a complex with other adhesion molecules in keratinocytes, and the complex can be retrieved by immunoprecipitation steps.
Figure 2Purified nCOL17 autoantigen complex and its analysis. (a) Western blotting of Cas9(+) HaCaT and DDDDK-COL17 HaCaT using an anti-COL17 antibody shows that endogenous COL17 was detected in both Cas9(+) HaCaT and DDDDK-COL17 HaCaT cell lysates. The final samples immunoprecipitated with anti-DDDDK antibodies showed a positive band only in the DDDDK-COL17 HaCaT. (b) Coomassie Brilliant Blue staining of immunoprecipitated DDDDK-COL17 HaCaT shows not only180-kDa bands but also additional 250, 160, 130 and 120-kDa bands (arrows). (c) DDDDK-COL17 HaCaT specific bands corresponded to cell adhesion molecules detected by LC-MS/MS. (d) Comparison of rCOL17 and nCOL17 content proteins by western blotting. A complex of full-length COL17 (black arrows), processed COL17 (red arrows), ITGα6/β4, and E-cad (black arrowheads) was confirmed in nCOL17. COL17, collagen XVII; E-cad, E-cadherin; kDa, kilodalton; LC-MS/MS, liquid chromatography with tandem mass spectrometry; nCOL17, native COL17; rCOL17, recombinant COL17.
We hypothesized that nCOL17, along with its binding partners in the complex, would improve the diagnostic sensitivity for BP. As a control, we revisited the rCOL17 ELISA (
) and performed receiver operating characteristic analysis. Sera from 30 patients with BP and 30 age-matched non-BP individuals were tested, reproducing the previous study (Figure 3a and b ) (
. Then, we tested an ELISA that was based on the nCOL17 autoantigen complex from DDDDK-COL17 HaCaT (hereinafter: the nCOL17 ELISA) using the same sample set (Figure 3c), and receiver operating characteristic analysis was performed in the same manner (Figure 3d). Based on the receiver operating characteristic analysis, we determined the cutoff value for the nCOL17 ELISA as 10.25, with a sensitivity of 90.0% and a specificity of 86.7%. These data show that nCOL17 ELISA is comparable, but not superior, to the rCOL17 ELISA in detecting BP autoantibodies.
Figure 3The diagnostic performance of rCOL17 and nCOL17 ELISAs on BP. (a) Scatter plot representation of rCOL17 ELISA index. (b) ROC analysis of rCOL17 ELISA. (c) Scatterplot representation of the nCOL17 ELISA index. (d) ROC analysis to determine a cutoff value for the nCOL17 ELISA. (e) Scatter plot of rCOL17 ELISA indices and nCOL17 ELISA indices of BP sera (n = 50). (f) The nCOL17 ELISA-preferential BP sera were positive not only for the 180-kDa of the COL17 (black arrows) but also for other extra bands (red arrows). BP, bullous pemphigoid; COL17, collagen XVII; nCOL17, native COL17; rCOL17, recombinant COL17; ROC, receiver operating characteristic; kDa, kilodalton.
Next, we wondered whether the nCOL17 complex could capture more diverse autoantibodies than rCOL17. To test this hypothesis, we performed the rCOL17 ELISA and the nCOL17 ELISA using another set of BP sera (n = 50). Of 50, 44 (88.0%) BP sera were positive in the nCOL17 ELISA; 46 of 50 (92.0%) BP sera were positive in the rCOL17 ELISA. The nCOL17 ELISA indices significantly correlated with the rCOL17 ELISA indices (R2 = 0.8275, p < 0.0001) (Figure 3e). As expected, some sera showed higher ELISA indices with nCOL17 than with rCOL17. Western blotting of BP sera for nCOL17 showed a 180-kDa band in 48 out of 50 sera (Figure 4). A total of 21 out of 50 sera reacted to a short fragment of COL17, and these reactions were also observed for sera that were not nCOL17 ELISA-predominant. A comparison between rCOL17 and nCOL17 western blotting was performed using sera in which the nCOL17 ELISA showed higher index values than the rCOL17 ELISA showed (Figure 3f). Some of these sera (numbers #2, #5, and #8) targeted not only full-length COL17, but also short COL17 fragments (Figure 3f).
Figure 4Western blotting using BP sera with nCOL17 as a substrate. The BP sera were positive for the 180-kDa of the COL17 (black arrows) and other extra bands (red arrows). DDDDK: anti-DDDDK antibody; COL17: anti-COL17 antibody. BP, bullous pemphigoid; COL17, collagen XVII; nCOL17, native COL17; kDa, kilodalton.
nCOL17 ELISA is superior to rCOL17 ELISA in terms of MMP autoantibody detection
The greater heterogeneity of MMP autoantigens distinguishes MMP from BP. Therefore, we speculated that nCOL17 might provide greater improvements to diagnostic sensitivity for MMP than for BP. We compared the nCOL17 ELISA to the rCOL17 ELISA using 55 MMP sera. Interestingly, only 26 of 55 (47.3%) of the MMP sera were positive in the rCOL17 ELISA, which is consistent with a previous study (
), whereas 39 of 55 (70.9%) of the MMP sera were positive in the nCOL17 ELISA, indicating that the MMP sera preferentially reacted with the isolated nCOL17 (Figure 5a). These data show that the nCOL17 ELISA is superior to the rCOL17 ELISA in MMP detection.
Figure 5The nCOL17 ELISA detects not only COL17 but also autoantibodies to ITGs in patients with MMP. (a) Scatter plot of rCOL17 ELISA indices and nCOL17 ELISA indices of MMP sera (n = 55). Based on the cutoff values of each of the ELISAs in the diagnosis of BP, the green region indicates positive for both ELISAs (r+n+), the red indicates positive only for the nCOL17 ELISA (r-n+), the orange indicates positive only for the nCOL17 ELISA (r-n+), and the blue indicates negative for both ELISAs (r-n-). (b) CBB staining of full-length ITGα6 (purple arrow) and ITGβ4 (green arrow). (c) Western blotting of full-length ITGα6 (purple arrow) and ITGβ4 (green arrow). (d) Western blotting using 55 MMP sera with nCOL17 as a substrate. In addition to the 180-kDa COL17 (strong: black arrow, weak: gray), other extra bands (red arrows) and approximately 205-kDa ITGβ4 (green arrow) were observed. DDDDK: anti-DDDDK antibody; COL17: anti-COL17 antibody, #1–55: MMP sera. (e) Western blotting using MMP sera with recombinant full-length ITGα6. #1–55: MMP sera, ITGα6: anti-ITGα6 antibody. The purple arrow indicates positive reactivity for ITGα6 bands. (f) Western blotting using MMP sera with recombinant full-length ITGβ4. ITGβ4: anti-ITGβ4 antibody. The green arrow indicates positive reactivity for ITGβ4 bands. #, number; BP, bullous pemphigoid; CBB, Coomassie brilliant blue; COL17, collagen XVII; nCOL17, native COL17; rCOL17, recombinant COL17; ITG, integrin; kDa, kilodalton; MMP, mucous membrane pemphigoid.
We subdivided MMP sera into four groups: positive for both ELISAs (r+n+) (n = 25), positive only for the nCOL17 ELISA (r-n+) (n = 14), positive only for the rCOL17 ELISA (r+n-) (n = 1), and negative for both ELISAs (r–n–) (n = 15). The clinical characteristics for each group of 55 MMP samples according to the results of the two ELISAs are shown in Table 1. No apparent phenotypic features were specific to any group.
As expected, the sera from the r+n+ patients with MMP, which showed high rCOL17 indices, were distributed along the BP approximate line obtained in Figure 3e. To further delineate the immunological profiles of each MMP group, western blotting of nCOL17 was performed on all of the MMP sera (n = 55) (Figure 5d). Sera that reacted strongly with 180-kDa COL17 were 15 of 25 (60.0%) of r+n+ MMP sera, 3 of 14 (21.4%) of r-n+ MMP sera and 2 of 15 (13.3%) of r-n- MMP sera. Notably, bands of various molecular weights other than 180-kDa were observed in many of the MMP sera, suggesting that these MMP sera had autoantibodies against processed COL17 and molecules other than COL17.
MMP autoantibodies specifically reacting with nCOL17 may target ITGα6/β4
As the isolated nCOL17 forms a complex with ITGα6/β4 (Figure 2a–d), MMP sera predominantly reacting with the nCOL17 ELISA might react with ITGα6/β4. We produced DDDDK-tagged recombinants of full-length ITGα6 and ITGβ4 proteins to test this hypothesis. The expressed recombinant full-length ITGα6/β4 showed a band at 115-kDa for ITGα6 and at 205-kDa for ITGβ4 by Coomassie brilliant blue staining (Figure 5b). The bands were found at the same positions, respectively, by western blotting with DDDDK (Figure 5c). Western blotting using these recombinant proteins was performed using all the 55 MMP sera. Of 55, 5 (9.1%) sera showed a faint reaction with ITGα6 (Figures 5e), 5 of 55 (9.1%) MMP sera reacted strongly with ITGβ4, and 5 of 55 (9.1%) reacted weakly with ITGβ4 (Figure 5f); all five of the MMP sera that reacted strongly with ITGβ4 were positive in the nCOL17 ELISA (Figure 5f). Intriguingly, 10 of 15 MMP sera that reacted with ITGα6 or ITGβ4 (Figure 5e and f) were also positive for 180-kDa COL17 (Figure 5d), suggesting the involvement of intermolecular epitope spreading. These data indicate that MMP is categorized into two groups: (i) a disease that predominantly targets COL17, and (ii) a disease that targets other molecules, including ITGα6/β4. The combination of rCOL17 and nCOL17 ELISAs can distinguish between these MMP subtypes.
Regarding autoantigen–phenotype correlation, autoantibodies targeting ITGα6 and ITGβ4 have been associated with oral and ocular mucosal lesions in MMP, respectively (
Bullous pemphigoid antigen II (BP180) and its soluble extracellular domains are major autoantigens in mucous membrane pemphigoid: the pathogenic relevance to HLA class II alleles and disease severity.
In this study, we successfully used gene editing to isolate the nCOL17 complex. Our ELISA system that uses the nCOL17 complex is superior to the rCOL17 ELISA in detecting MMP autoantibodies because the nCOL17 complex harbors various autoantigens, including full-length and processed COL17 and ITGα6/β4.
We performed nCOL17 ELISA and nCOL17 western blotting for all BP and MMP sera and compared the detection rates of autoantibodies. For BP sera, 44 of 50 (88%) were positive in nCOL17 ELISA and 48 of 50 (96%) were positive for 180-kDa COL17 in nCOL17 western blotting. For MMP sera, nCOL17 western blotting showed strong and weakly reacting MMP sera to 180-kDa COL17, but the combined number of these sera did not reach the sensitivity of the nCOL17 ELISA. However, the cumulative sensitivity of ITGβ4 (the 250-kDa band indicated by the green arrow in Figure 5d) and COL17 in western blotting was comparable to that of nCOL17 ELISA. Western blotting is useful for autoantibody detection and the identification of individual target antigens, whereas nCOL17 ELISA has advantages in quantifying antibody titers and achieving a high throughput.
Regarding autoantigen–phenotype correlation, previous studies have shown that autoantibodies to ITGβ4 are associated with ocular involvement (
Bullous pemphigoid antigen II (BP180) and its soluble extracellular domains are major autoantigens in mucous membrane pemphigoid: the pathogenic relevance to HLA class II alleles and disease severity.
). Li et al. reported that 62.8% of pure ocular MMP sera reacted with ITGβ4 and that 58.1% and 27.9% reacted with COL17 and laminin-332, respectively (
). We also created recombinant ITGβ4 and examined whether there was a relationship between anti-ITGβ4 antibodies and ocular lesions; however, no correlation was found. One reason for this discrepancy from the previous studies may be the difference in the study population. In contrast, Maglie et al. reported that anti-ITGβ4 antibodies did not significantly correlate with ocular MMP, similar to this study (
), both of which are COL17-binding partners. However, mass spectrometry and western blotting failed to detect BP230 and laminin-332 in the nCOL17 complex. One possible explanation is the increased insolubility of the nCOL17 complex after it forms HD-like structures, which makes it difficult to immunoprecipitate from the cell lysates. We unsuccessfully attempted to solubilize the HD-like complexes using the ULTRARIPA kit for Lipid Raft (BioDynamics Laboratory) or an ammonia solution (data not shown). Further studies are warranted to purify BP230 and laminin-332 from the nCOL17 complex. We instead examined the identical reactivity of MMP sera for BP230, COL7, and laminin-332, individually. A total of 6 of 55 (10.9%) MMP sera were positive for BP230, 3 of 55 (5.5%) for COL7, and 14 of 55 (25.5%) for laminin-332 (Figure 6), also summarized in Table 4. Surprisingly, 24 of 55 (43.6%) of the MMP sera reacted to multiple autoantigens, indicating that heterogeneous autoantibodies are retained in MMP, even in individual patients. This suggests that the nCOL17 ELISA strategy using an autoantigen complex containing multiple autoantigens as substrates is reasonable.
Figure 6Western blotting using MMP sera with purified laminin-332. MMP sera reacted with the α3 chain (160-kDa and 145-kDa), β3 chain (140-kDa), and γ2 chain (105-kDa), which are indicated by red arrows. kDa, kilodalton; MMP, mucous membrane pemphigoid.
In contrast, 6 of 39 (15.4%) MMP autoantibodies showed no reaction in western blotting for nCOL17 or ITGα6β4, despite being positive for nCOL17 ELISA. Three of these six sera reacted with the epidermal side by indirect immunofluorescence using 1 M NaCl-split normal human skin, suggesting that the nCOL17 autoantigen complex may contain unknown autoantigens other than COL17 and ITGα6/β4. Previous studies have shown that 45-kDa (
). The identification of unknown MMP autoantigens needs further investigation.
A notable difference between nCOL17 and rCOL17 is that the former is post-translationally modified in HaCaT in a physiological setting. We found that several BP sera reacted more preferentially with the nCOL17 ELISA than with the rCOL17 ELISA and recognized not only full-length COL17 but also the short (approximately 160-kDa and 120-kDa linear IgA disease antigen 1) form of COL17 (Figure 3f). These data are consistent with earlier studies reporting that specific BP autoantibodies may target processed fragments of COL17 (
) and indicate that the nCOL17 ELISA is useful for detecting autoantibodies targeting physiologically processed COL17. In other words, our study points to the antigenicity of physiologically cleaved COL17, which is consistent with our earlier study reporting that the C-terminal truncation of COL17 significantly affects its antigenicity (
). The involvement of other posttranslational modifications, including phosphorylation and glycosylation, in COL17 antigenicity will be explored with our nCOL17 system. The N-terminal truncated 160-kDa fragment of COL17 is poorly known, and it has not been confirmed whether this fragment is present in vivo in humans. Some BP sera reacted with 160-kDa COL17; however, this study did not investigate whether this is involved in the pathogenesis of BP.
Furthermore, there was a difference in molecular weight between nCOL17-derived ITGα6/β4 and recombinant ITGα6/β4. The molecular weight of nCOL17-derived ITGβ4 was found to be approximately 250-kDa and that of ITGα6 was approximately 130-kDa. However, that of recombinant ITGβ4 was found to be 205-kDa, and that of recombinant ITGα6 was found to be 115-kDa, and these agree with a previous report (
). This discrepancy in molecular weights suggests that post-translational modification affects nCOL17-derived ITGα6/β4. ITGβ4 has five and ITGα6 has six N-glycosylation potential sites (
). Thus, it is possible that the native ITGα6/β4 derived from the nCOL17 complex could be larger than its known molecular weight because of the N-glycosylation or other modifications. Thus, it is possible that N-glycosylation or other modifications of the native ITGα6/β4 derived from the nCOL17 complex may improve anti-ITGα6/β4 IgG detection with nCOL17 ELISA compared with recombinant ITGα6/β4.
Although the nCOL17 complex contains multiple basement membrane proteins and short COL17 fragments, the nCOL17 ELISA did not improve the sensitivity or specificity for the diagnosis of BP. In fact, none of the 50 BP sera showed any positive reactivity against recombinant ITGα6 and ITGβ4 (data not shown). It is not obvious from the results of this study whether the addition of the shorter fragment of COL17 increased the sensitivity of the nCOL17 ELISA.
Interestingly, the nCOL17 complex obtained in this study also contained small amounts of E-cadherin, DSG-1, DSG-3, and desmocollin-1. These findings confirm that COL17 is present not only at the basement membrane but also at cell–cell contact sites (
Antibody-binding to the 180-kD bullous pemphigoid antigens at the lateral cell surface causes their internalization and inhibits their assembly at the basal cell surface in cultured keratinocytes.
In conclusion, we have developed a simple method for isolating native autoantigen complexes for pemphigoid diseases (Figure 7). The newly developed nCOL17 ELISA enables us to detect MMP autoantibodies targeting not only COL17 but also COL17-binding autoantigens, including ITGα6/β4. This method is expected to be applicable to other autoimmune diseases.
Figure 7A summarized scheme illustrating the comparison of the nCOL17 ELISA with other available ELISAs. The nCOL17 ELISA can detect autoantibodies for various types of pemphigoid diseases. COL17, collagen XVII; nCOL17, native COL17.
HaCaT were infected with pLenti-EF1a-Cas9-Puro lentiviral particles (APB) to stably express Cas9 protein, according to the manufacturer’s protocol. The cells were cultured in DMEM (Invitrogen, Waltham, MA) containing 10% fetal bovine serum, and antibiotic-resistant clones were selected under 1 μg/ml of puromycin (Thermo Fisher Scientific, Waltham, MA). All cultures were maintained in a 5% CO2, 37 °C humidified incubator.
Construction of guide RNA and the single-strand nucleotide template
To target exon 2 of the COL17A1 genomic sequence (NG_007069.1), guide RNA (5′-TCCTGCAGGTGGCTATGGTA-3′) was designed by Optimized CRISPR Design (http://crispr.mit.edu/). Template single-strand oligonucleotides with the DDDDK-tag sequence and the 3′ and 5′ homology arms were synthesized (System Biosciences, Palo Alto, CA) as follows: 5′-ACAATGATAAGTATGACTATCATGGTTTCTGATTTTTCCTGCAGGTGGCTGCGGCCGCCATGGACTACAAGGACGACGATGACAAGGATGTAACCAAGAAAAACAAACGAGATGGAACTGAAGTCACTGAGAGAA -3′. (Underlined: NotI, bold: DDDDK-tag)
The guide RNA and template single-strand DNA were cotransfected to the Cas9(+) HaCaT using RNAiMax (Thermo Fisher Scientific) according to the manufacturer’s protocol. The HaCaT were plated at a low density to get well-separated colonies.
Immunofluorescent staining
The cells were cultured on a chamber slide (ibidi) for 48 hours. The cells were washed with PBS and fixed with 4% paraformaldehyde at room temperature (RT) for 10 minutes. After permeabilization with 0.1% Triton X-100 in PBS for 20 minutes at RT, the cells were incubated with 3% BSA in PBS for 30 minutes and washed once with 10 mM glycine in PBS. Primary antibodies anti-DDDDK (FLAG-M2, Sigma-Aldrich, St. Louis, MO, 1:500 dilution) and anti-COL17 NC16A (11-NC16A, final concentration 1 μg/ml) (
) were incubated for 1 hour at RT. As secondary antibodies, goat anti-mouse IgG Alexa Fluor 546 (Invitrogen A11003, 1:1,000 dilution) and goat anti-rabbit IgG Alexa Fluor 488 (Invitrogen A21206, 1:1,000 dilution) were incubated for 1 hour at RT. Then the cells were washed in PBS three times for 5 minutes. The nuclei were stained with DAPI (Life Technologies, Carlsbad, CA). Th photo images were taken by fluorescence microscopy (Olympus, Carlsbad, CA).
Isolation of nCOL17, and western blotting
HaCaT and HEK293TN cells were grown to confluency. Cell lysis was prepared by using a lysis buffer (1% [v/v] nonidet P-40 [Nacalai Tesque, Kyoto, Japan]), 25 mM Tris-HCl (pH 7.4), 100 mM NaCl, 10 mM EDTA, and a 1:100 diluted protease inhibitor cocktail (P8340, Sigma-Aldrich). The whole-cell lysate was centrifuged at 13,000 r.p.m. at 4 °C for 20 minutes and then immunoprecipitated with anti-DDDDK-tag mAb-magnetic beads, followed by elution with DDDDK peptide (Sigma-Aldrich). Protein samples were denatured for 5 minutes at 95°C in 5× loading buffer (0.25 M Tris-HCl; 8% SDS; 30% glycerol; 0.02% bromophenol blue; 0.3 M β-mercaptoethanol; pH 6.8). Samples were run on a 7 or 10% SDS-PAGE system, followed by Coomassie brilliant blue staining. For western blotting, proteins were separated by SDS-PAGE and then electrophoretically transferred onto nitrocellulose membranes (BioRad, Hercules, CA). After the transfer, the membranes were blocked with 2% skim milk, followed by incubation with rabbit anti-human COL17 IgG (
), mouse anti-DDDDK IgG (FLAG-M2, Sigma-Aldrich, 1:500 dilution), rabbit anti-ITGα6 IgG (HPA012696, Cell Signaling, Danvers, MA, 1:1,000 dilution), mouse anti-ITGβ4 IgG (sc-514426, Santa Cruz Biotechnology, Santa Cruz, CA, 1:100 dilution) or rabbit anti- E-cadherin IgG (24E10, Cell Signaling, 1:1,000 dilution) for 2 hours at RT. As secondary antibodies, peroxidase-conjugated anti-mouse IgG (Jackson Immunoresearch, West Grove, PA) or anti-rabbit IgG (Invitrogen) was diluted 1:5,000 in 2% skim milk blocking buffer, and the membrane was incubated for 1 hour at RT. Signals were visualized by Clarity Western ECL Substrate (BioRad) and detected by the LAS-4000 mini-Imager (Fujifilm, Lexington, MA).
Mass spectrometry
A nanoLC device (EASY-nLC, Thermo Fisher Scientific) was equipped with an analytical column (NTCC-360/75-3-125, Nikkyo Technos, Tokyo, Japan) and linked to a Thermo LTQ Orbitrap Discovery mass spectrometer (Thermo Fisher Scientific). Then, 4 μL of the sample was introduced into the column and was eluted with a linear gradient composed of buffer A (2% acetonitrile and 0.1% formic acid in water) and buffer B (10% H2O, 90% acetonitrile, and 0.1% formic acid) at a flow rate of 300 nL/min (0-20 minutes, 0-35% buffer B; 20–35 minutes, 35–95% buffer B). Mass spectrometry data between 400 and 1600 m/z were acquired from the Orbitrap. The data were acquired and processed using the Proteome Discoverer software.
Serum samples
Serum samples were obtained from patients with BP or MMP. The samples were collected by the Department of Dermatology at Hokkaido University in Sapporo, Japan, and by the University of Freiburg, Germany. They were diagnosed based on clinical, histopathological, and immunological findings as previously described (
). The patients with BP had tense blisters on the skin lesions, and circulating antibasement membrane zone IgG was confirmed by reactivity against the epidermal side in indirect immunofluorescence using 1 M NaCl-split normal human skin. The MMP cases had predominantly mucosal manifestations, and either direct or indirect immunofluorescence confirmed antibasement membrane zone IgG. The sera from the patients who did not suffer from autoimmune blistering diseases were used as controls. All studies using human materials were performed according to the principles of the Declaration of Helsinki. The collection of human samples was approved by the local ethics committee, the institutional review board of Hokkaido University (15-025), and the University of Freiburg (235/15). Written informed consent was obtained from all participants.
ELISA using rCOL17 and nCOL17
The pcDNA5/FRT expression vector with full-length human COL17 cDNA tagged with N-terminal DDDDK was cotransfected with pOG44 (Invitrogen) into Flp-In 293 cells (Invitrogen) by Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. These cells stably expressed rCOL17 and were cultured, lysed, and immunoprecipitated as previously described (
). ELISA was performed using rCOL17 or nCOL17 to detect IgG autoantibodies from patients with BP. Briefly, ELISA plates were coated with rCOL17 or nCOL17. The final concentration of total protein used in the nCOL17 ELISA was 2 μg/ml. After washing and blocking with a blocking reagent for ELISA (Roche, Basal, Switzerland), the BP or MMP sera were diluted to 1:100 and added to PBS and incubated for 1 hour at RT. After washing, 1:10,000 diluted horseradish peroxidase-conjugated mouse anti-human IgG antibody was added, and the plates were further incubated for 1 hour at RT. Finally, TMB was added as a substrate, and the absorbance was measured at 450 nm with the correlation wavelength set at 620 nm by a microplate reader (TECAN Austria GmbH, Grödig, Austria). The following formula defined the ELISA index value: index = (OD450 of the tested serum – OD450 of the negative control) / (OD450 of the positive control – OD450 of the negative control) ×100. The positive controls were pooled sera from BP reacting with the NC16A domain of COL17, and the negative controls were sera from healthy individuals.
Production of recombinant ITGα6, ITGβ4, and western blotting
The cDNA containing the entire coding region of ITGα6 (NM_000210.2) was subcloned into the pcDNA5/FRT (Invitrogen) expression vector, and ITGβ4 (NM_000213) cDNA was purchased (TOYOBO, Osaka, Japan) and subcloned into the pcDNA3.1 expression vector. Full-length ITGα6 and ITGβ4 were C-terminally tagged with DDDDK. The pcDNA5/FRT expression vector with DDDDK-ITGα6 was transfected with pOG44 (Invitrogen) into Flp-In 293 cells (Invitrogen) by Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. The pcDNA3.1 expression vector with DDDDK-ITGβ4 was transfected into HEK293TN cells (System Biosciences) by Lipofectamine 2000 (Invitrogen). These cells stably expressed DDDDK- ITGα6 or ITGβ4 and were cultured, lysed, and immunoprecipitated as described above. Samples were run on a 7 or 10% SDS-PAGE, followed by Coomassie brilliant blue staining and western blotting. After the transfer, the membranes were blocked with 2% skim milk followed by incubation for 2 hours at RT with rabbit anti-ITGα6 IgG or anti-ITGβ4 or mouse anti-DDDDK IgG as described above. Secondary antibodies were treated as described above.
Purified laminin-332 western blotting
Purified laminin-332 was courtesy provided from Amano, Shiseido Life Science Research Center, Yokohama, Japan (
). The sample was run on a 7% SDS-PAGE gel, followed by western blotting. After the transfer, the membrane was blocked with 2% skim milk followed by incubation for 2 hours at RT with rabbit anti-laminin5 antibody (ab14509, abcam, 1:1,000). The secondary antibody was horseradish peroxidase-conjugated anti-rabbit IgG antibody (Invitrogen) diluted (1:5,000) in 2% skim milk PBS and reacted for 1 hour at RT.
Statistical analysis
Non-BP controls and patients with BP or MMP were compared in terms of the Ncol17 index and the rCOL17 ELISA index by the Mann–Whitney test. Receiver operating characteristic analysis was performed to determine the cutoff, specificity, and sensitivity between non-BP and BP or MMP. The association between the nCOL17 ELISA and rCOL17 ELISA indexes of BP sera was examined by Pearson’s correlation and linear regression analysis. All statistical analyses were performed with GraphPad Prism 9.3 (GraphPad Software, San Diego, CA).
Data availability statement
No datasets were generated or analyzed during this study.
FS was funded by the Berta-Ottenstein-Programme for Advanced Clinician Scientists, Faculty of Medicine, University of Freiburg. The remaining authors state no conflict of interest.
Acknowledgments
We thank Nami Ikeshita and Miho Yamashita for their expert technical assistance. We also thank the Global Facility Center at Hokkaido University for allowing us to conduct mass spectrometric analysis. We thank Kim B. Yancey for providing us with the human COL17A1 cDNA-expressing vector. We thank Satoshi Amano for providing purified laminin-332. This work was supported by JSPS KAKENHI Grant Number JP 20K17334 to KI, by Research on Measures for Intractable Diseases from the Ministry of Health, Labor, and Welfare of Japan to HU, and by AMED under grant number JP20ek0109430 to HU.
Author Contributions
Conceptualization: SM, WN; Data Curation: SM, YM, KN, NI, DS, FS, DK, WN; Formal Analysis: SM, YM, KI, WN; Funding Acquisition: KI, WN; Investigation: SM, YM, FS, DK, WN; Supervision: HU, KI, WN; Writing - Original Draft Preparation: SM, WN, KI; Writing - Review and Editing: SM, YM, KN, NI, DS, FS, DK, WN, HU
References
Aho S.
Uitto J.
Direct interaction between the intracellular domains of bullous pemphigoid antigen 2 (BP180) and beta 4 integrin, hemidesmosomal components of basal keratinocytes.
The first international consensus on mucous membrane pemphigoid: definition, diagnostic criteria, pathogenic factors, medical treatment, and prognostic indicators.
Epiligrin, the major human keratinocyte integrin ligand, is a target in both an acquired autoimmune and an inherited subepidermal blistering skin disease.
Molecular genetic studies of a human epidermal autoantigen (the 180-kD bullous pemphigoid antigen/BP180): identification of functionally important sequences within the BP180 molecule and evidence for an interaction between BP180 and alpha 6 integrin.
The N terminus of the transmembrane protein BP180 interacts with the N-terminal domain of BP230, thereby mediating keratin cytoskeleton anchorage to the cell surface at the site of the hemidesmosome.
Antibody-binding to the 180-kD bullous pemphigoid antigens at the lateral cell surface causes their internalization and inhibits their assembly at the basal cell surface in cultured keratinocytes.
Bullous pemphigoid antigen II (BP180) and its soluble extracellular domains are major autoantigens in mucous membrane pemphigoid: the pathogenic relevance to HLA class II alleles and disease severity.
European guidelines (S3) on diagnosis and management of mucous membrane pemphigoid, initiated by the European Academy of Dermatology and Venereology – part I.
Hemidesmosome formation is initiated by the β4 integrin subunit, requires complex formation of β4 and HD1/plectin, and involves a direct interaction between β4 and the Bullous pemphigoid antigen 180.
European Guidelines (S3) on diagnosis and management of mucous membrane pemphigoid, initiated by the European Academy of Dermatology and Venereology – part II.
Clinical and immunological studies of 332 Japanese patients tentatively diagnosed as anti-BP180-type mucous membrane pemphigoid: a novel BP180 C-terminal domain enzyme-linked immunosorbent assay.
00015-2&id=gr1.jpg){kind=link}
00015-2&id=gr2.jpg){kind=link}
00015-2&id=gr3.jpg){kind=link}
00015-2&id=gr4.jpg){kind=link}
00015-2&id=gr5.jpg){kind=link}
00015-2&id=gr6.jpg){kind=link}
00015-2&id=gr7.jpg){kind=link}